ID: 1085859651

View in Genome Browser
Species Human (GRCh38)
Location 11:80216771-80216793
Sequence TTCCTCCATTTTTGCTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859651_1085859652 -8 Left 1085859651 11:80216771-80216793 CCAGGCAAGCAAAAATGGAGGAA No data
Right 1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG No data
1085859651_1085859653 -3 Left 1085859651 11:80216771-80216793 CCAGGCAAGCAAAAATGGAGGAA No data
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859651 Original CRISPR TTCCTCCATTTTTGCTTGCC TGG (reversed) Intergenic
No off target data available for this crispr