ID: 1085859653

View in Genome Browser
Species Human (GRCh38)
Location 11:80216791-80216813
Sequence GAAATTCATCACCACTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085859647_1085859653 26 Left 1085859647 11:80216742-80216764 CCTCAGAAATGAAGGAGAAATAG No data
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data
1085859646_1085859653 27 Left 1085859646 11:80216741-80216763 CCCTCAGAAATGAAGGAGAAATA 0: 39
1: 229
2: 839
3: 1388
4: 2020
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data
1085859651_1085859653 -3 Left 1085859651 11:80216771-80216793 CCAGGCAAGCAAAAATGGAGGAA No data
Right 1085859653 11:80216791-80216813 GAAATTCATCACCACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085859653 Original CRISPR GAAATTCATCACCACTGGAC TGG Intergenic
No off target data available for this crispr