ID: 1085865225

View in Genome Browser
Species Human (GRCh38)
Location 11:80282832-80282854
Sequence CCTTATCAACAGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085865225_1085865231 13 Left 1085865225 11:80282832-80282854 CCTGCTGCCCTCTGTTGATAAGG No data
Right 1085865231 11:80282868-80282890 GATCACAGCTGAATGATATAGGG No data
1085865225_1085865232 14 Left 1085865225 11:80282832-80282854 CCTGCTGCCCTCTGTTGATAAGG No data
Right 1085865232 11:80282869-80282891 ATCACAGCTGAATGATATAGGGG No data
1085865225_1085865230 12 Left 1085865225 11:80282832-80282854 CCTGCTGCCCTCTGTTGATAAGG No data
Right 1085865230 11:80282867-80282889 GGATCACAGCTGAATGATATAGG No data
1085865225_1085865229 -9 Left 1085865225 11:80282832-80282854 CCTGCTGCCCTCTGTTGATAAGG No data
Right 1085865229 11:80282846-80282868 TTGATAAGGCAAAGAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085865225 Original CRISPR CCTTATCAACAGAGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr