ID: 1085866287

View in Genome Browser
Species Human (GRCh38)
Location 11:80298212-80298234
Sequence GGAATTGCCGAGGTAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085866287_1085866290 -6 Left 1085866287 11:80298212-80298234 CCTTTAATTACCTCGGCAATTCC No data
Right 1085866290 11:80298229-80298251 AATTCCCTGAGTAGTGACGTGGG No data
1085866287_1085866289 -7 Left 1085866287 11:80298212-80298234 CCTTTAATTACCTCGGCAATTCC No data
Right 1085866289 11:80298228-80298250 CAATTCCCTGAGTAGTGACGTGG No data
1085866287_1085866291 -5 Left 1085866287 11:80298212-80298234 CCTTTAATTACCTCGGCAATTCC No data
Right 1085866291 11:80298230-80298252 ATTCCCTGAGTAGTGACGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085866287 Original CRISPR GGAATTGCCGAGGTAATTAA AGG (reversed) Intergenic