ID: 1085866291

View in Genome Browser
Species Human (GRCh38)
Location 11:80298230-80298252
Sequence ATTCCCTGAGTAGTGACGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085866286_1085866291 -2 Left 1085866286 11:80298209-80298231 CCTCCTTTAATTACCTCGGCAAT No data
Right 1085866291 11:80298230-80298252 ATTCCCTGAGTAGTGACGTGGGG No data
1085866287_1085866291 -5 Left 1085866287 11:80298212-80298234 CCTTTAATTACCTCGGCAATTCC No data
Right 1085866291 11:80298230-80298252 ATTCCCTGAGTAGTGACGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085866291 Original CRISPR ATTCCCTGAGTAGTGACGTG GGG Intergenic