ID: 1085868191

View in Genome Browser
Species Human (GRCh38)
Location 11:80319621-80319643
Sequence ATGTTTTCCTGGAAGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085868191_1085868193 -4 Left 1085868191 11:80319621-80319643 CCATCTCTCTTCCAGGAAAACAT No data
Right 1085868193 11:80319640-80319662 ACATTCCTAATCCCCTATTATGG No data
1085868191_1085868200 11 Left 1085868191 11:80319621-80319643 CCATCTCTCTTCCAGGAAAACAT No data
Right 1085868200 11:80319655-80319677 TATTATGGACTAAGTGTCTGGGG No data
1085868191_1085868198 9 Left 1085868191 11:80319621-80319643 CCATCTCTCTTCCAGGAAAACAT No data
Right 1085868198 11:80319653-80319675 CCTATTATGGACTAAGTGTCTGG No data
1085868191_1085868199 10 Left 1085868191 11:80319621-80319643 CCATCTCTCTTCCAGGAAAACAT No data
Right 1085868199 11:80319654-80319676 CTATTATGGACTAAGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085868191 Original CRISPR ATGTTTTCCTGGAAGAGAGA TGG (reversed) Intergenic
No off target data available for this crispr