ID: 1085874309

View in Genome Browser
Species Human (GRCh38)
Location 11:80387577-80387599
Sequence TTGTCTCTGCATTGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085874309_1085874313 -3 Left 1085874309 11:80387577-80387599 CCTTCCACTCAATGCAGAGACAA No data
Right 1085874313 11:80387597-80387619 CAAAATAAGGGCTCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085874309 Original CRISPR TTGTCTCTGCATTGAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr