ID: 1085875988

View in Genome Browser
Species Human (GRCh38)
Location 11:80406354-80406376
Sequence GAGCTGTGTGCTTATATCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085875988_1085875995 30 Left 1085875988 11:80406354-80406376 CCGCTGATATAAGCACACAGCTC No data
Right 1085875995 11:80406407-80406429 TGACACTTCAGCCCCACAGGAGG No data
1085875988_1085875994 27 Left 1085875988 11:80406354-80406376 CCGCTGATATAAGCACACAGCTC No data
Right 1085875994 11:80406404-80406426 CACTGACACTTCAGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085875988 Original CRISPR GAGCTGTGTGCTTATATCAG CGG (reversed) Intergenic
No off target data available for this crispr