ID: 1085883110

View in Genome Browser
Species Human (GRCh38)
Location 11:80491115-80491137
Sequence ATCTAGGAAGGGCTGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085883110_1085883115 21 Left 1085883110 11:80491115-80491137 CCTTAGGACAGCCCTTCCTAGAT No data
Right 1085883115 11:80491159-80491181 TCCTCATCCACCTTTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085883110 Original CRISPR ATCTAGGAAGGGCTGTCCTA AGG (reversed) Intergenic
No off target data available for this crispr