ID: 1085884444

View in Genome Browser
Species Human (GRCh38)
Location 11:80505842-80505864
Sequence CCGACTTGAGACTGCTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085884444_1085884447 -3 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884447 11:80505862-80505884 CGGCCTAGGACGCTCCAGATTGG No data
1085884444_1085884451 3 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884451 11:80505868-80505890 AGGACGCTCCAGATTGGTAGGGG No data
1085884444_1085884450 2 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884450 11:80505867-80505889 TAGGACGCTCCAGATTGGTAGGG No data
1085884444_1085884454 9 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884454 11:80505874-80505896 CTCCAGATTGGTAGGGGTAGGGG No data
1085884444_1085884452 7 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884452 11:80505872-80505894 CGCTCCAGATTGGTAGGGGTAGG No data
1085884444_1085884453 8 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884453 11:80505873-80505895 GCTCCAGATTGGTAGGGGTAGGG No data
1085884444_1085884449 1 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884449 11:80505866-80505888 CTAGGACGCTCCAGATTGGTAGG No data
1085884444_1085884456 27 Left 1085884444 11:80505842-80505864 CCAGCGTAGCAGTCTCAAGTCGG No data
Right 1085884456 11:80505892-80505914 AGGGGCGTCCACCATTACTGAGG 0: 84
1: 419
2: 900
3: 1384
4: 1803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085884444 Original CRISPR CCGACTTGAGACTGCTACGC TGG (reversed) Intergenic
No off target data available for this crispr