ID: 1085892864

View in Genome Browser
Species Human (GRCh38)
Location 11:80601838-80601860
Sequence CTGTCTGTGCAGAAGTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085892864_1085892867 -1 Left 1085892864 11:80601838-80601860 CCACAGTACTTCTGCACAGACAG No data
Right 1085892867 11:80601860-80601882 GCTTCCCTGGCACCTCTTCCGGG No data
1085892864_1085892866 -2 Left 1085892864 11:80601838-80601860 CCACAGTACTTCTGCACAGACAG No data
Right 1085892866 11:80601859-80601881 AGCTTCCCTGGCACCTCTTCCGG No data
1085892864_1085892873 29 Left 1085892864 11:80601838-80601860 CCACAGTACTTCTGCACAGACAG No data
Right 1085892873 11:80601890-80601912 CATTGCAGTGCATCTCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085892864 Original CRISPR CTGTCTGTGCAGAAGTACTG TGG (reversed) Intergenic
No off target data available for this crispr