ID: 1085894110

View in Genome Browser
Species Human (GRCh38)
Location 11:80616778-80616800
Sequence GAATATAAAATGGTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085894110_1085894116 9 Left 1085894110 11:80616778-80616800 CCTAGCTCCACCATTTTATATTC No data
Right 1085894116 11:80616810-80616832 TAGTTTCCTCACCTGAAAATAGG 0: 3
1: 11
2: 114
3: 1018
4: 4816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085894110 Original CRISPR GAATATAAAATGGTGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr