ID: 1085894520

View in Genome Browser
Species Human (GRCh38)
Location 11:80622508-80622530
Sequence AGTTGGATTTTGAACCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085894520_1085894525 5 Left 1085894520 11:80622508-80622530 CCATCTGGGTTCAAAATCCAACT No data
Right 1085894525 11:80622536-80622558 CCAGGCCTATCAAGGTCAGATGG No data
1085894520_1085894523 -3 Left 1085894520 11:80622508-80622530 CCATCTGGGTTCAAAATCCAACT No data
Right 1085894523 11:80622528-80622550 ACTCAACTCCAGGCCTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085894520 Original CRISPR AGTTGGATTTTGAACCCAGA TGG (reversed) Intergenic
No off target data available for this crispr