ID: 1085900977

View in Genome Browser
Species Human (GRCh38)
Location 11:80699570-80699592
Sequence CAGTGCTCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085900971_1085900977 23 Left 1085900971 11:80699524-80699546 CCTGCCGGATCCGGAGGGGTGGA 0: 12
1: 72
2: 148
3: 164
4: 147
Right 1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG No data
1085900969_1085900977 24 Left 1085900969 11:80699523-80699545 CCCTGCCGGATCCGGAGGGGTGG 0: 14
1: 74
2: 165
3: 149
4: 153
Right 1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG No data
1085900972_1085900977 19 Left 1085900972 11:80699528-80699550 CCGGATCCGGAGGGGTGGAAATC No data
Right 1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG No data
1085900973_1085900977 13 Left 1085900973 11:80699534-80699556 CCGGAGGGGTGGAAATCAAAGAC No data
Right 1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085900977 Original CRISPR CAGTGCTCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr