ID: 1085901338

View in Genome Browser
Species Human (GRCh38)
Location 11:80703371-80703393
Sequence AACATGGAGGTGGGTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085901327_1085901338 30 Left 1085901327 11:80703318-80703340 CCCTGAAGGGGCTATCATAGTAA No data
Right 1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG No data
1085901328_1085901338 29 Left 1085901328 11:80703319-80703341 CCTGAAGGGGCTATCATAGTAAT No data
Right 1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085901338 Original CRISPR AACATGGAGGTGGGTAGAGA TGG Intergenic
No off target data available for this crispr