ID: 1085902404

View in Genome Browser
Species Human (GRCh38)
Location 11:80717100-80717122
Sequence TTATATGAGCATAAAGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085902403_1085902404 4 Left 1085902403 11:80717073-80717095 CCTTAAAGAAAATATGCTGTGTT No data
Right 1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG No data
1085902402_1085902404 30 Left 1085902402 11:80717047-80717069 CCAACTTTCAGGGATACTTATAG No data
Right 1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085902404 Original CRISPR TTATATGAGCATAAAGCTGA AGG Intergenic
No off target data available for this crispr