ID: 1085904947

View in Genome Browser
Species Human (GRCh38)
Location 11:80749149-80749171
Sequence ATGTGGGTTTACAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085904942_1085904947 10 Left 1085904942 11:80749116-80749138 CCAAGAGTTAAATAGTCGATGCA No data
Right 1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085904947 Original CRISPR ATGTGGGTTTACAGGGAAGA TGG Intergenic
No off target data available for this crispr