ID: 1085916274

View in Genome Browser
Species Human (GRCh38)
Location 11:80891882-80891904
Sequence CCTTTAATAGGCTATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085916274_1085916278 -4 Left 1085916274 11:80891882-80891904 CCTGCTTCATAGCCTATTAAAGG No data
Right 1085916278 11:80891901-80891923 AAGGGAATTCTGTCTGTGCTTGG No data
1085916274_1085916279 5 Left 1085916274 11:80891882-80891904 CCTGCTTCATAGCCTATTAAAGG No data
Right 1085916279 11:80891910-80891932 CTGTCTGTGCTTGGTAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085916274 Original CRISPR CCTTTAATAGGCTATGAAGC AGG (reversed) Intergenic
No off target data available for this crispr