ID: 1085916277

View in Genome Browser
Species Human (GRCh38)
Location 11:80891894-80891916
Sequence CAGACAGAATTCCCTTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085916277_1085916279 -7 Left 1085916277 11:80891894-80891916 CCTATTAAAGGGAATTCTGTCTG No data
Right 1085916279 11:80891910-80891932 CTGTCTGTGCTTGGTAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085916277 Original CRISPR CAGACAGAATTCCCTTTAAT AGG (reversed) Intergenic
No off target data available for this crispr