ID: 1085916279

View in Genome Browser
Species Human (GRCh38)
Location 11:80891910-80891932
Sequence CTGTCTGTGCTTGGTAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085916277_1085916279 -7 Left 1085916277 11:80891894-80891916 CCTATTAAAGGGAATTCTGTCTG No data
Right 1085916279 11:80891910-80891932 CTGTCTGTGCTTGGTAAACAAGG No data
1085916274_1085916279 5 Left 1085916274 11:80891882-80891904 CCTGCTTCATAGCCTATTAAAGG No data
Right 1085916279 11:80891910-80891932 CTGTCTGTGCTTGGTAAACAAGG No data
1085916273_1085916279 23 Left 1085916273 11:80891864-80891886 CCAGTCTTCTCAGACTATCCTGC No data
Right 1085916279 11:80891910-80891932 CTGTCTGTGCTTGGTAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085916279 Original CRISPR CTGTCTGTGCTTGGTAAACA AGG Intergenic
No off target data available for this crispr