ID: 1085916884

View in Genome Browser
Species Human (GRCh38)
Location 11:80900833-80900855
Sequence CATTTGTCCTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085916878_1085916884 26 Left 1085916878 11:80900784-80900806 CCTAGATCTTGAATAAGATATGG No data
Right 1085916884 11:80900833-80900855 CATTTGTCCTAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085916884 Original CRISPR CATTTGTCCTAGAAGGAAGA AGG Intergenic
No off target data available for this crispr