ID: 1085919967

View in Genome Browser
Species Human (GRCh38)
Location 11:80942102-80942124
Sequence AAAGCTGAGTTGCCCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085919964_1085919967 17 Left 1085919964 11:80942062-80942084 CCTGATCAGGGCATATTTCTAGT No data
Right 1085919967 11:80942102-80942124 AAAGCTGAGTTGCCCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085919967 Original CRISPR AAAGCTGAGTTGCCCCATAT TGG Intergenic
No off target data available for this crispr