ID: 1085919998

View in Genome Browser
Species Human (GRCh38)
Location 11:80942453-80942475
Sequence GTGCTAGCTATGTGACTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085919998_1085920000 17 Left 1085919998 11:80942453-80942475 CCAACCAGTCACATAGCTAGCAC No data
Right 1085920000 11:80942493-80942515 TCCCCATGTCTATGTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085919998 Original CRISPR GTGCTAGCTATGTGACTGGT TGG (reversed) Intergenic
No off target data available for this crispr