ID: 1085932193

View in Genome Browser
Species Human (GRCh38)
Location 11:81097168-81097190
Sequence CATAGCTATCACATTTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085932192_1085932193 4 Left 1085932192 11:81097141-81097163 CCATGTGTTATCTCATTTAATTT No data
Right 1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085932193 Original CRISPR CATAGCTATCACATTTAAAC AGG Intergenic
No off target data available for this crispr