ID: 1085937098

View in Genome Browser
Species Human (GRCh38)
Location 11:81159883-81159905
Sequence TACCTAGGCCTCCCACAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085937094_1085937098 -9 Left 1085937094 11:81159869-81159891 CCTCGTGATGCACCTACCTAGGC No data
Right 1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085937098 Original CRISPR TACCTAGGCCTCCCACAGGC GGG Intergenic
No off target data available for this crispr