ID: 1085941903

View in Genome Browser
Species Human (GRCh38)
Location 11:81214631-81214653
Sequence AACTTGAGAGAGATGATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085941903_1085941905 4 Left 1085941903 11:81214631-81214653 CCCTAAATCATCTCTCTCAAGTT No data
Right 1085941905 11:81214658-81214680 GTTCCACAAGTCTCTACAGCAGG No data
1085941903_1085941907 6 Left 1085941903 11:81214631-81214653 CCCTAAATCATCTCTCTCAAGTT No data
Right 1085941907 11:81214660-81214682 TCCACAAGTCTCTACAGCAGGGG No data
1085941903_1085941906 5 Left 1085941903 11:81214631-81214653 CCCTAAATCATCTCTCTCAAGTT No data
Right 1085941906 11:81214659-81214681 TTCCACAAGTCTCTACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085941903 Original CRISPR AACTTGAGAGAGATGATTTA GGG (reversed) Intergenic