ID: 1085941903 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:81214631-81214653 |
Sequence | AACTTGAGAGAGATGATTTA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1085941903_1085941905 | 4 | Left | 1085941903 | 11:81214631-81214653 | CCCTAAATCATCTCTCTCAAGTT | No data | ||
Right | 1085941905 | 11:81214658-81214680 | GTTCCACAAGTCTCTACAGCAGG | No data | ||||
1085941903_1085941907 | 6 | Left | 1085941903 | 11:81214631-81214653 | CCCTAAATCATCTCTCTCAAGTT | No data | ||
Right | 1085941907 | 11:81214660-81214682 | TCCACAAGTCTCTACAGCAGGGG | No data | ||||
1085941903_1085941906 | 5 | Left | 1085941903 | 11:81214631-81214653 | CCCTAAATCATCTCTCTCAAGTT | No data | ||
Right | 1085941906 | 11:81214659-81214681 | TTCCACAAGTCTCTACAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1085941903 | Original CRISPR | AACTTGAGAGAGATGATTTA GGG (reversed) | Intergenic | ||