ID: 1085941904

View in Genome Browser
Species Human (GRCh38)
Location 11:81214632-81214654
Sequence GAACTTGAGAGAGATGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085941904_1085941906 4 Left 1085941904 11:81214632-81214654 CCTAAATCATCTCTCTCAAGTTC No data
Right 1085941906 11:81214659-81214681 TTCCACAAGTCTCTACAGCAGGG No data
1085941904_1085941907 5 Left 1085941904 11:81214632-81214654 CCTAAATCATCTCTCTCAAGTTC No data
Right 1085941907 11:81214660-81214682 TCCACAAGTCTCTACAGCAGGGG No data
1085941904_1085941905 3 Left 1085941904 11:81214632-81214654 CCTAAATCATCTCTCTCAAGTTC No data
Right 1085941905 11:81214658-81214680 GTTCCACAAGTCTCTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085941904 Original CRISPR GAACTTGAGAGAGATGATTT AGG (reversed) Intergenic