ID: 1085941905 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:81214658-81214680 |
| Sequence | GTTCCACAAGTCTCTACAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1085941904_1085941905 | 3 | Left | 1085941904 | 11:81214632-81214654 | CCTAAATCATCTCTCTCAAGTTC | No data | ||
| Right | 1085941905 | 11:81214658-81214680 | GTTCCACAAGTCTCTACAGCAGG | No data | ||||
| 1085941903_1085941905 | 4 | Left | 1085941903 | 11:81214631-81214653 | CCCTAAATCATCTCTCTCAAGTT | No data | ||
| Right | 1085941905 | 11:81214658-81214680 | GTTCCACAAGTCTCTACAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1085941905 | Original CRISPR | GTTCCACAAGTCTCTACAGC AGG | Intergenic | ||