ID: 1085941905

View in Genome Browser
Species Human (GRCh38)
Location 11:81214658-81214680
Sequence GTTCCACAAGTCTCTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085941903_1085941905 4 Left 1085941903 11:81214631-81214653 CCCTAAATCATCTCTCTCAAGTT No data
Right 1085941905 11:81214658-81214680 GTTCCACAAGTCTCTACAGCAGG No data
1085941904_1085941905 3 Left 1085941904 11:81214632-81214654 CCTAAATCATCTCTCTCAAGTTC No data
Right 1085941905 11:81214658-81214680 GTTCCACAAGTCTCTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085941905 Original CRISPR GTTCCACAAGTCTCTACAGC AGG Intergenic