ID: 1085946359

View in Genome Browser
Species Human (GRCh38)
Location 11:81277904-81277926
Sequence CAGTTTGCACAGAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085946359_1085946365 -8 Left 1085946359 11:81277904-81277926 CCTCCCTCTCTCTGTGCAAACTG No data
Right 1085946365 11:81277919-81277941 GCAAACTGGTAAAAGGCCTTGGG 0: 13
1: 24
2: 27
3: 29
4: 174
1085946359_1085946364 -9 Left 1085946359 11:81277904-81277926 CCTCCCTCTCTCTGTGCAAACTG No data
Right 1085946364 11:81277918-81277940 TGCAAACTGGTAAAAGGCCTTGG 0: 27
1: 28
2: 23
3: 29
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085946359 Original CRISPR CAGTTTGCACAGAGAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr