ID: 1085949067

View in Genome Browser
Species Human (GRCh38)
Location 11:81307558-81307580
Sequence ACAACTATGGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085949067_1085949070 -7 Left 1085949067 11:81307558-81307580 CCTTCCTCTTTCTCCATAGTTGT No data
Right 1085949070 11:81307574-81307596 TAGTTGTTGCCCTCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085949067 Original CRISPR ACAACTATGGAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr