ID: 1085953714

View in Genome Browser
Species Human (GRCh38)
Location 11:81365213-81365235
Sequence CTAATAAGAAACCCTGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085953710_1085953714 23 Left 1085953710 11:81365167-81365189 CCATTGACAATCAAATGTATGAT No data
Right 1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG No data
1085953711_1085953714 -10 Left 1085953711 11:81365200-81365222 CCCTATACCTTGTCTAATAAGAA No data
Right 1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG No data
1085953709_1085953714 28 Left 1085953709 11:81365162-81365184 CCGAGCCATTGACAATCAAATGT No data
Right 1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085953714 Original CRISPR CTAATAAGAAACCCTGTATA TGG Intergenic
No off target data available for this crispr