ID: 1085956280

View in Genome Browser
Species Human (GRCh38)
Location 11:81400076-81400098
Sequence CTGGAAATACTGAACAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085956280_1085956284 10 Left 1085956280 11:81400076-81400098 CCTTGTTTGTTCAGTATTTCCAG No data
Right 1085956284 11:81400109-81400131 CTTGCAGAAACAGAAGATGTAGG No data
1085956280_1085956285 25 Left 1085956280 11:81400076-81400098 CCTTGTTTGTTCAGTATTTCCAG No data
Right 1085956285 11:81400124-81400146 GATGTAGGATCAGCCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085956280 Original CRISPR CTGGAAATACTGAACAAACA AGG (reversed) Intergenic
No off target data available for this crispr