ID: 1085961041

View in Genome Browser
Species Human (GRCh38)
Location 11:81462193-81462215
Sequence ATCTGCTTGAAGCTGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085961039_1085961041 -6 Left 1085961039 11:81462176-81462198 CCTTGGTGACAGCATGCATCTGC No data
Right 1085961041 11:81462193-81462215 ATCTGCTTGAAGCTGTCTGAGGG No data
1085961038_1085961041 -5 Left 1085961038 11:81462175-81462197 CCCTTGGTGACAGCATGCATCTG No data
Right 1085961041 11:81462193-81462215 ATCTGCTTGAAGCTGTCTGAGGG No data
1085961037_1085961041 0 Left 1085961037 11:81462170-81462192 CCATTCCCTTGGTGACAGCATGC No data
Right 1085961041 11:81462193-81462215 ATCTGCTTGAAGCTGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085961041 Original CRISPR ATCTGCTTGAAGCTGTCTGA GGG Intergenic
No off target data available for this crispr