ID: 1085961301

View in Genome Browser
Species Human (GRCh38)
Location 11:81465748-81465770
Sequence AAGGGCCACTTGAACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085961289_1085961301 30 Left 1085961289 11:81465695-81465717 CCAGGCGTGCTAGCGCGCACCTG No data
Right 1085961301 11:81465748-81465770 AAGGGCCACTTGAACTGGGGAGG No data
1085961295_1085961301 2 Left 1085961295 11:81465723-81465745 CCAGCTACTTGGGCAGCTGAGGC 0: 83
1: 4087
2: 92485
3: 202905
4: 241637
Right 1085961301 11:81465748-81465770 AAGGGCCACTTGAACTGGGGAGG No data
1085961293_1085961301 3 Left 1085961293 11:81465722-81465744 CCCAGCTACTTGGGCAGCTGAGG 0: 105
1: 5097
2: 105981
3: 215725
4: 253986
Right 1085961301 11:81465748-81465770 AAGGGCCACTTGAACTGGGGAGG No data
1085961292_1085961301 11 Left 1085961292 11:81465714-81465736 CCTGTAGTCCCAGCTACTTGGGC 0: 142
1: 43401
2: 158186
3: 225218
4: 229335
Right 1085961301 11:81465748-81465770 AAGGGCCACTTGAACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085961301 Original CRISPR AAGGGCCACTTGAACTGGGG AGG Intergenic
No off target data available for this crispr