ID: 1085963936

View in Genome Browser
Species Human (GRCh38)
Location 11:81498085-81498107
Sequence GCTCAAGTATGTGCATTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085963934_1085963936 7 Left 1085963934 11:81498055-81498077 CCAATAAGATCTCAGGAGTTGGG 0: 90
1: 184
2: 227
3: 159
4: 209
Right 1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG No data
1085963932_1085963936 8 Left 1085963932 11:81498054-81498076 CCCAATAAGATCTCAGGAGTTGG 0: 61
1: 270
2: 373
3: 255
4: 265
Right 1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085963936 Original CRISPR GCTCAAGTATGTGCATTAAA AGG Intergenic
No off target data available for this crispr