ID: 1085964076

View in Genome Browser
Species Human (GRCh38)
Location 11:81499263-81499285
Sequence ATTAGGCTTTTCTTCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085964072_1085964076 -5 Left 1085964072 11:81499245-81499267 CCTCCATTGCTAACAACTATTAG No data
Right 1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG No data
1085964069_1085964076 10 Left 1085964069 11:81499230-81499252 CCCCTCATTATACTTCCTCCATT No data
Right 1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG No data
1085964070_1085964076 9 Left 1085964070 11:81499231-81499253 CCCTCATTATACTTCCTCCATTG No data
Right 1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG No data
1085964074_1085964076 -8 Left 1085964074 11:81499248-81499270 CCATTGCTAACAACTATTAGGCT No data
Right 1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG No data
1085964071_1085964076 8 Left 1085964071 11:81499232-81499254 CCTCATTATACTTCCTCCATTGC No data
Right 1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085964076 Original CRISPR ATTAGGCTTTTCTTCCTTGA GGG Intergenic
No off target data available for this crispr