ID: 1085964890

View in Genome Browser
Species Human (GRCh38)
Location 11:81510782-81510804
Sequence CCATTAGCATTGAACTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085964883_1085964890 10 Left 1085964883 11:81510749-81510771 CCTGATTTGTATTTCTCCCCGAA No data
Right 1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG No data
1085964887_1085964890 -8 Left 1085964887 11:81510767-81510789 CCGAATGTGGCTCAACCATTAGC No data
Right 1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG No data
1085964885_1085964890 -6 Left 1085964885 11:81510765-81510787 CCCCGAATGTGGCTCAACCATTA No data
Right 1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG No data
1085964886_1085964890 -7 Left 1085964886 11:81510766-81510788 CCCGAATGTGGCTCAACCATTAG No data
Right 1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG No data
1085964882_1085964890 14 Left 1085964882 11:81510745-81510767 CCTTCCTGATTTGTATTTCTCCC No data
Right 1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085964890 Original CRISPR CCATTAGCATTGAACTTAGG AGG Intergenic
No off target data available for this crispr