ID: 1085969741

View in Genome Browser
Species Human (GRCh38)
Location 11:81573477-81573499
Sequence TACTGGGGCCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085969735_1085969741 4 Left 1085969735 11:81573450-81573472 CCAAAAAAAAAAAATTTAAATCA No data
Right 1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085969741 Original CRISPR TACTGGGGCCAGAGGGAAGA TGG Intergenic
No off target data available for this crispr