ID: 1085976499

View in Genome Browser
Species Human (GRCh38)
Location 11:81661465-81661487
Sequence CACAATGCACAGATGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085976499_1085976509 26 Left 1085976499 11:81661465-81661487 CCATGCCCCATCTGTGCATTGTG No data
Right 1085976509 11:81661514-81661536 CCCCTCTCCACGTCCATGTCTGG No data
1085976499_1085976511 27 Left 1085976499 11:81661465-81661487 CCATGCCCCATCTGTGCATTGTG No data
Right 1085976511 11:81661515-81661537 CCCTCTCCACGTCCATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085976499 Original CRISPR CACAATGCACAGATGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr