ID: 1085976785

View in Genome Browser
Species Human (GRCh38)
Location 11:81665253-81665275
Sequence ATCTCATTCTTCATGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085976785_1085976788 27 Left 1085976785 11:81665253-81665275 CCCTCTTACATGAAGAATGAGAT No data
Right 1085976788 11:81665303-81665325 ACTCACAGATGTGTTGTAGAGGG No data
1085976785_1085976787 26 Left 1085976785 11:81665253-81665275 CCCTCTTACATGAAGAATGAGAT No data
Right 1085976787 11:81665302-81665324 AACTCACAGATGTGTTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085976785 Original CRISPR ATCTCATTCTTCATGTAAGA GGG (reversed) Intergenic
No off target data available for this crispr