ID: 1085980404

View in Genome Browser
Species Human (GRCh38)
Location 11:81717867-81717889
Sequence AGGAAAACTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085980395_1085980404 28 Left 1085980395 11:81717816-81717838 CCATTCCCATGGTAGCAGCTGCA No data
Right 1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG No data
1085980397_1085980404 23 Left 1085980397 11:81717821-81717843 CCCATGGTAGCAGCTGCATGGCA No data
Right 1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG No data
1085980398_1085980404 22 Left 1085980398 11:81717822-81717844 CCATGGTAGCAGCTGCATGGCAT No data
Right 1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085980404 Original CRISPR AGGAAAACTGCAGTGATTGT GGG Intergenic
No off target data available for this crispr