ID: 1085981479

View in Genome Browser
Species Human (GRCh38)
Location 11:81731485-81731507
Sequence GATTTCCACTGAAAAGTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085981474_1085981479 -1 Left 1085981474 11:81731463-81731485 CCCACTCTCCCCTGGCTTGTAAG No data
Right 1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG No data
1085981472_1085981479 23 Left 1085981472 11:81731439-81731461 CCTTCAACACTTTAAATATGTCA 0: 21
1: 267
2: 503
3: 532
4: 749
Right 1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG No data
1085981476_1085981479 -9 Left 1085981476 11:81731471-81731493 CCCCTGGCTTGTAAGATTTCCAC No data
Right 1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG No data
1085981477_1085981479 -10 Left 1085981477 11:81731472-81731494 CCCTGGCTTGTAAGATTTCCACT No data
Right 1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG No data
1085981475_1085981479 -2 Left 1085981475 11:81731464-81731486 CCACTCTCCCCTGGCTTGTAAGA No data
Right 1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085981479 Original CRISPR GATTTCCACTGAAAAGTCTG CGG Intergenic
No off target data available for this crispr