ID: 1085983131

View in Genome Browser
Species Human (GRCh38)
Location 11:81748880-81748902
Sequence ATGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085983131_1085983138 13 Left 1085983131 11:81748880-81748902 CCCTTCTCCTTCTCCTTCTTCAT No data
Right 1085983138 11:81748916-81748938 AGGGTCTCTCTGTGTTGCCCAGG 0: 72
1: 2008
2: 17992
3: 65348
4: 160005
1085983131_1085983139 17 Left 1085983131 11:81748880-81748902 CCCTTCTCCTTCTCCTTCTTCAT No data
Right 1085983139 11:81748920-81748942 TCTCTCTGTGTTGCCCAGGCTGG 0: 248
1: 7647
2: 71126
3: 172315
4: 259047
1085983131_1085983136 -7 Left 1085983131 11:81748880-81748902 CCCTTCTCCTTCTCCTTCTTCAT No data
Right 1085983136 11:81748896-81748918 TCTTCATTTTGGATAGAGACAGG No data
1085983131_1085983137 -6 Left 1085983131 11:81748880-81748902 CCCTTCTCCTTCTCCTTCTTCAT No data
Right 1085983137 11:81748897-81748919 CTTCATTTTGGATAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085983131 Original CRISPR ATGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr