ID: 1085984744

View in Genome Browser
Species Human (GRCh38)
Location 11:81771993-81772015
Sequence GAAGTGAACTTCTCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085984738_1085984744 28 Left 1085984738 11:81771942-81771964 CCCTATTCAGACAGAAGGATCCC No data
Right 1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG No data
1085984739_1085984744 27 Left 1085984739 11:81771943-81771965 CCTATTCAGACAGAAGGATCCCA No data
Right 1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG No data
1085984741_1085984744 7 Left 1085984741 11:81771963-81771985 CCAGAAGAATTGTCATGTCTATG No data
Right 1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG No data
1085984740_1085984744 8 Left 1085984740 11:81771962-81771984 CCCAGAAGAATTGTCATGTCTAT No data
Right 1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085984744 Original CRISPR GAAGTGAACTTCTCTAAAAC AGG Intergenic
No off target data available for this crispr