ID: 1085992754

View in Genome Browser
Species Human (GRCh38)
Location 11:81870122-81870144
Sequence GTTGTTAAGCGTATTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085992754_1085992761 29 Left 1085992754 11:81870122-81870144 CCACCCACAATACGCTTAACAAC No data
Right 1085992761 11:81870174-81870196 TCATGTAAGACTCCTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085992754 Original CRISPR GTTGTTAAGCGTATTGTGGG TGG (reversed) Intergenic
No off target data available for this crispr