ID: 1085995413

View in Genome Browser
Species Human (GRCh38)
Location 11:81906598-81906620
Sequence TTCTTTCCGTGTTCATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085995413_1085995416 6 Left 1085995413 11:81906598-81906620 CCATCCTATGAACACGGAAAGAA No data
Right 1085995416 11:81906627-81906649 AAGTCTGATAGGCAAATGTGAGG No data
1085995413_1085995419 24 Left 1085995413 11:81906598-81906620 CCATCCTATGAACACGGAAAGAA No data
Right 1085995419 11:81906645-81906667 TGAGGGAAGAAACTTTGCAAGGG No data
1085995413_1085995418 23 Left 1085995413 11:81906598-81906620 CCATCCTATGAACACGGAAAGAA No data
Right 1085995418 11:81906644-81906666 GTGAGGGAAGAAACTTTGCAAGG No data
1085995413_1085995415 -5 Left 1085995413 11:81906598-81906620 CCATCCTATGAACACGGAAAGAA No data
Right 1085995415 11:81906616-81906638 AAGAAGTGTCAAAGTCTGATAGG No data
1085995413_1085995417 7 Left 1085995413 11:81906598-81906620 CCATCCTATGAACACGGAAAGAA No data
Right 1085995417 11:81906628-81906650 AGTCTGATAGGCAAATGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085995413 Original CRISPR TTCTTTCCGTGTTCATAGGA TGG (reversed) Intergenic
No off target data available for this crispr