ID: 1085996966

View in Genome Browser
Species Human (GRCh38)
Location 11:81929536-81929558
Sequence ACTTGGATCTACCTGTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085996961_1085996966 14 Left 1085996961 11:81929499-81929521 CCCTTACTCCTCCTTAGACATCA No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data
1085996963_1085996966 6 Left 1085996963 11:81929507-81929529 CCTCCTTAGACATCATGCAGAAT No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data
1085996962_1085996966 13 Left 1085996962 11:81929500-81929522 CCTTACTCCTCCTTAGACATCAT No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data
1085996959_1085996966 26 Left 1085996959 11:81929487-81929509 CCTGCCAGGTCACCCTTACTCCT No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data
1085996960_1085996966 22 Left 1085996960 11:81929491-81929513 CCAGGTCACCCTTACTCCTCCTT No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data
1085996964_1085996966 3 Left 1085996964 11:81929510-81929532 CCTTAGACATCATGCAGAATTAA No data
Right 1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085996966 Original CRISPR ACTTGGATCTACCTGTAAAC TGG Intergenic
No off target data available for this crispr