ID: 1086004922

View in Genome Browser
Species Human (GRCh38)
Location 11:82026812-82026834
Sequence CTGTAGAAAAGGTCGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086004922_1086004927 7 Left 1086004922 11:82026812-82026834 CCTCTTTCCGACCTTTTCTACAG No data
Right 1086004927 11:82026842-82026864 TGACCTCTCCCCTACTCCCCAGG No data
1086004922_1086004932 22 Left 1086004922 11:82026812-82026834 CCTCTTTCCGACCTTTTCTACAG No data
Right 1086004932 11:82026857-82026879 TCCCCAGGCTGCTCCTTGCCAGG 0: 57
1: 229
2: 165
3: 119
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086004922 Original CRISPR CTGTAGAAAAGGTCGGAAAG AGG (reversed) Intergenic
No off target data available for this crispr