ID: 1086004922 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:82026812-82026834 |
| Sequence | CTGTAGAAAAGGTCGGAAAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086004922_1086004927 | 7 | Left | 1086004922 | 11:82026812-82026834 | CCTCTTTCCGACCTTTTCTACAG | No data | ||
| Right | 1086004927 | 11:82026842-82026864 | TGACCTCTCCCCTACTCCCCAGG | No data | ||||
| 1086004922_1086004932 | 22 | Left | 1086004922 | 11:82026812-82026834 | CCTCTTTCCGACCTTTTCTACAG | No data | ||
| Right | 1086004932 | 11:82026857-82026879 | TCCCCAGGCTGCTCCTTGCCAGG | 0: 57 1: 229 2: 165 3: 119 4: 454 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086004922 | Original CRISPR | CTGTAGAAAAGGTCGGAAAG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||