ID: 1086010784

View in Genome Browser
Species Human (GRCh38)
Location 11:82100920-82100942
Sequence TTTCCTCTATTTTGCACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086010784_1086010787 24 Left 1086010784 11:82100920-82100942 CCACAGGTGCAAAATAGAGGAAA No data
Right 1086010787 11:82100967-82100989 ATGATGTATAAGAAATTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086010784 Original CRISPR TTTCCTCTATTTTGCACCTG TGG (reversed) Intergenic