ID: 1086010787

View in Genome Browser
Species Human (GRCh38)
Location 11:82100967-82100989
Sequence ATGATGTATAAGAAATTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086010784_1086010787 24 Left 1086010784 11:82100920-82100942 CCACAGGTGCAAAATAGAGGAAA No data
Right 1086010787 11:82100967-82100989 ATGATGTATAAGAAATTCATAGG No data
1086010785_1086010787 -7 Left 1086010785 11:82100951-82100973 CCTCACCTGTCATGAGATGATGT No data
Right 1086010787 11:82100967-82100989 ATGATGTATAAGAAATTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086010787 Original CRISPR ATGATGTATAAGAAATTCAT AGG Intergenic