ID: 1086010787 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:82100967-82100989 |
| Sequence | ATGATGTATAAGAAATTCAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086010784_1086010787 | 24 | Left | 1086010784 | 11:82100920-82100942 | CCACAGGTGCAAAATAGAGGAAA | No data | ||
| Right | 1086010787 | 11:82100967-82100989 | ATGATGTATAAGAAATTCATAGG | No data | ||||
| 1086010785_1086010787 | -7 | Left | 1086010785 | 11:82100951-82100973 | CCTCACCTGTCATGAGATGATGT | No data | ||
| Right | 1086010787 | 11:82100967-82100989 | ATGATGTATAAGAAATTCATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086010787 | Original CRISPR | ATGATGTATAAGAAATTCAT AGG | Intergenic | ||